| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.134483 |
| Chromosome: | chromosome 6 |
| Location: | 7581424 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g301000 | (1 of 107) PF00069//PF07714 - Protein kinase domain (Pkinase) // Protein tyrosine kinase (Pkinase_Tyr) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCGGAAACGATTCCGATTCCGAGCTCGCA |
| Internal bar code: | TTGTGGGGTCGTCATTCCCGTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 176 |
| LEAP-Seq percent confirming: | 99.729 |
| LEAP-Seq n confirming: | 368 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AACGCCGGAATACTATGTGC |
| Suggested primer 2: | GGCAAACCTACTACGGCATC |