| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.134493 |
| Chromosome: | chromosome 12 |
| Location: | 5422914 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g530050 | IPP7 | similar to inositol polyphosphate phosphatase; (1 of 2) 3.1.3.36 - Phosphoinositide 5-phosphatase / Type II inositol-1,4,5-trisphosphate 5-phosphatase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCGACCCCATAGCCAGTACCGTCTTACCAC |
| Internal bar code: | TGTACTTCGTGTCGCGCCTAGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1124 |
| LEAP-Seq percent confirming: | 99.6486 |
| LEAP-Seq n confirming: | 3403 |
| LEAP-Seq n nonconfirming: | 12 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGGACTACAACTGCTGCCTG |
| Suggested primer 2: | AGAAAGGATGTGACGCTGCT |