Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.134527 |
Chromosome: | chromosome 16 |
Location: | 944603 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g648650 | (1 of 32) IPR006502 - Protein of unknown function PDDEXK-like | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGCCAGAATGAACTCGGCACCTAGCAAGC |
Internal bar code: | ATGCTTCGTGAAGCGGGCGGGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 448 |
LEAP-Seq percent confirming: | 99.8732 |
LEAP-Seq n confirming: | 3938 |
LEAP-Seq n nonconfirming: | 5 |
LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ATCCTAACCCCTCCCATACG |
Suggested primer 2: | TCTTAATGTTGGACCTGCCC |