Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.134621 |
Chromosome: | chromosome 6 |
Location: | 1950416 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g263750 | RPN15 | component of lid subcomplex of 26S proteasome regulatory subunit; (1 of 2) PF05160 - DSS1/SEM1 family (DSS1_SEM1) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGTTGATTACTGCGCGCCAGGATCGGGAGC |
Internal bar code: | CGAGTATATGTGGCCGCGGCTG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 991 |
LEAP-Seq percent confirming: | 99.9152 |
LEAP-Seq n confirming: | 8245 |
LEAP-Seq n nonconfirming: | 7 |
LEAP-Seq n unique pos: | 36 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCCACACCAAATCGTCTTCT |
Suggested primer 2: | CTGCCTTACCACTGTCCCAT |