Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.134652 |
Chromosome: | chromosome 9 |
Location: | 2106765 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g393700 | MMP3 | Matrix metalloproteinase; (1 of 2) IPR016517 - Peptidase M11, autolysin | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCGGCAGCGGTGCGGTGTCGGTGTTCAGCA |
Internal bar code: | CTTGTTAGCCCGCCATGCCATT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 899 |
LEAP-Seq percent confirming: | 96.8764 |
LEAP-Seq n confirming: | 6420 |
LEAP-Seq n nonconfirming: | 207 |
LEAP-Seq n unique pos: | 48 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCTAACCCTGCTCGTCAAAG |
Suggested primer 2: | TACCTCACACTCCCACCTCC |