| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.134759 |
| Chromosome: | chromosome 13 |
| Location: | 1204539 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g570150 | (1 of 1) PTHR21689:SF2 - PROTEIN LIN-9 HOMOLOG | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGCAAAGCCGACTCGCGTGACTCGCATCAT |
| Internal bar code: | GCTCTGTCCAACCAGCGAAGTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 692 |
| LEAP-Seq percent confirming: | 99.1466 |
| LEAP-Seq n confirming: | 5228 |
| LEAP-Seq n nonconfirming: | 45 |
| LEAP-Seq n unique pos: | 21 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGTGTGATTTTGTCAGGTGG |
| Suggested primer 2: | TTGAGGTTGGGGTAGAGGTG |