Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.134760 |
Chromosome: | chromosome 11 |
Location: | 1678167 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre11.g467778 | (1 of 1) K00761 - uracil phosphoribosyltransferase (upp, UPRT) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCCAATGCAACCGAGCGAGGGGGGTGCGG |
Internal bar code: | CATTATGTTGCGTCTTTCTGGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 814 |
LEAP-Seq percent confirming: | 96.6203 |
LEAP-Seq n confirming: | 486 |
LEAP-Seq n nonconfirming: | 17 |
LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTGATGAGGAACAGGTCGGT |
Suggested primer 2: | TTCGCTTCTAAACCGCTCAT |