| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.134777 |
| Chromosome: | chromosome 14 |
| Location: | 2586465 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g625802 | (1 of 1) K10696 - E3 ubiquitin-protein ligase BRE1 [EC:6.3.2.19] (BRE1) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGTTTGATGCAAAGCGTTTGCATGAATGGC |
| Internal bar code: | GATCGGGTTTTCCTGTCGGGAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 514 |
| LEAP-Seq percent confirming: | 99.5655 |
| LEAP-Seq n confirming: | 14438 |
| LEAP-Seq n nonconfirming: | 63 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACACGCCATAAGGAATACGC |
| Suggested primer 2: | CTAAGCTGACGGTCCTGGAG |