| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.134979 |
| Chromosome: | chromosome 1 |
| Location: | 654993 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g003524 | (1 of 1) PF13499//PF14531 - EF-hand domain pair (EF-hand_7) // Kinase-like (Kinase-like) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCTGGCCTCATGACGGGCCATGTGGCGTT |
| Internal bar code: | ATGATTGCTGGTGAAGCGCGTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 817 |
| LEAP-Seq percent confirming: | 99.7177 |
| LEAP-Seq n confirming: | 12717 |
| LEAP-Seq n nonconfirming: | 36 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGCACTGGACCAATACACAC |
| Suggested primer 2: | CCACTCATCCATATCCCCAC |