| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.135056 |
| Chromosome: | chromosome 7 |
| Location: | 789594 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g318200 | CGLD34 | (1 of 2) IPR001214//IPR019734 - SET domain // Tetratricopeptide repeat; histone methyltransferase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTTGATGGTGCCCGTTTCCTGAAGTATTT |
| Internal bar code: | CAGCAGGTTTCTCTACGCATTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 301 |
| LEAP-Seq percent confirming: | 99.6607 |
| LEAP-Seq n confirming: | 6462 |
| LEAP-Seq n nonconfirming: | 22 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGTGTGTGCGTCTGTTTTGA |
| Suggested primer 2: | AAGGGAGAATGTTCATTGCG |