Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.135056 |
Chromosome: | chromosome 7 |
Location: | 789609 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g318200 | CGLD34 | (1 of 2) IPR001214//IPR019734 - SET domain // Tetratricopeptide repeat; histone methyltransferase | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TACAAGGATGGGAGCGTCCCCAGCTGTCCG |
Internal bar code: | CTAGTTCCGAACTTATCGCGCC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 341 |
LEAP-Seq percent confirming: | 99.4819 |
LEAP-Seq n confirming: | 1344 |
LEAP-Seq n nonconfirming: | 7 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AAGGGAGAATGTTCATTGCG |
Suggested primer 2: | TGTGTGTGCGTCTGTTTTGA |