| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.135067 |
| Chromosome: | chromosome 7 |
| Location: | 788680 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g318050 | (1 of 10) PF00170 - bZIP transcription factor (bZIP_1) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGCACATATACTATGTAGAAATGCGAAACA |
| Internal bar code: | TGGTGGAGTCTAGGGTAGGAAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 892 |
| LEAP-Seq percent confirming: | 99.5033 |
| LEAP-Seq n confirming: | 8615 |
| LEAP-Seq n nonconfirming: | 43 |
| LEAP-Seq n unique pos: | 51 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCAGACGCAGGTGATAGTGA |
| Suggested primer 2: | GGGCTACTGTGCTCGACTTC |