| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.135132 |
| Chromosome: | chromosome 17 |
| Location: | 3426495 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g724400 | FAP257 | Flagellar Associated Protein 257; (1 of 3) PF05217 - STOP protein (STOP) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGGTGCCACGTCTGCGGCGTGCGTAAATGC |
| Internal bar code: | AGCGAGTGCGCATTCTACTTGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 614 |
| LEAP-Seq percent confirming: | 98.5321 |
| LEAP-Seq n confirming: | 1074 |
| LEAP-Seq n nonconfirming: | 16 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCGGATTCAGGAGATTACGA |
| Suggested primer 2: | TCGCTTTGATATTGCGACAG |