Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.135144 |
Chromosome: | chromosome 1 |
Location: | 5144088 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g035800 | IRK2 | (1 of 2) PTHR11767//PTHR11767:SF47 - INWARD RECTIFIER POTASSIUM CHANNEL // SUBFAMILY NOT NAMED; Inwardly-rectifying potassium channel | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTGGTTCTCAGTCTACACCGCAGCCACGC |
Internal bar code: | ACAATTTCTGGCACGGCATCGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 127 |
LEAP-Seq percent confirming: | 95.2626 |
LEAP-Seq n confirming: | 925 |
LEAP-Seq n nonconfirming: | 46 |
LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACTGGACCGACATCTTCCAC |
Suggested primer 2: | AAGTTCTTGACCCCATCACG |