Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.135164 |
Chromosome: | chromosome 10 |
Location: | 4900506 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g454700 | (1 of 1) IPR001611//IPR003591//IPR025875 - Leucine-rich repeat // Leucine-rich repeat, typical subtype // Leucine rich repeat 4 | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGAAAACTCTTAACGTGGCATGGCTGAGAT |
Internal bar code: | AGGCTGTATCGAGGCTGAGGGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 339 |
LEAP-Seq percent confirming: | 5.21562 |
LEAP-Seq n confirming: | 179 |
LEAP-Seq n nonconfirming: | 3253 |
LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GAAGTTGAGCACCTTGAGGC |
Suggested primer 2: | CTGTTCGAGTGAGGAGGGAG |