| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.135169 |
| Chromosome: | chromosome 3 |
| Location: | 4250352 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g174150 | (1 of 9) IPR000210//IPR011042//IPR011333 - BTB/POZ domain // Six-bladed beta-propeller, TolB-like // POZ domain | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCATATTGAATGAATAGCAGTTATGGCGAC |
| Internal bar code: | TCAGTTCACTTTTTAAACCAAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 214 |
| LEAP-Seq percent confirming: | 99.5733 |
| LEAP-Seq n confirming: | 700 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCTGAGGATTTGCAGCACAC |
| Suggested primer 2: | ACTGTTGTCCGGGTTGAGTC |