| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.135199 |
| Chromosome: | chromosome 7 |
| Location: | 1081104 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g319800 | (1 of 1) IPR000104//IPR009148 - Antifreeze protein, type I // Streptococcal non-M secreted SibA | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGTCCGAGTGGCTGGCCGCCCGCCTGCGG |
| Internal bar code: | GGTTCGCGAAGGGCCCCGGAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 926 |
| LEAP-Seq percent confirming: | 86.6224 |
| LEAP-Seq n confirming: | 4306 |
| LEAP-Seq n nonconfirming: | 665 |
| LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGCAGATACAGCTGGACAGG |
| Suggested primer 2: | AACCAACTATCAACCGACGC |