Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.135258 |
Chromosome: | chromosome 13 |
Location: | 1917495 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre13.g576050 | ZIP2,CrZIP10 | (1 of 1) PTHR11040:SF61 - PROTEIN ZNTA; Zinc/iron transporter | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCACCGCTTCTTGGGCTCTTCGCACGTCTT |
Internal bar code: | GTTATGCGACAGGGGCGCGCAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 763 |
LEAP-Seq percent confirming: | 99.7341 |
LEAP-Seq n confirming: | 6001 |
LEAP-Seq n nonconfirming: | 16 |
LEAP-Seq n unique pos: | 30 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GAGGGTGAGGGTTGTTTTCA |
Suggested primer 2: | ATTCGAGTTGCACTGTGCTG |