| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.135467 |
| Chromosome: | chromosome 13 |
| Location: | 3313877 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g586500 | KIN17-2,KIN17B | (1 of 32) 3.6.4.4 - Plus-end-directed kinesin ATPase / Kinesin; Kinesin motor protein | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCATCGCAATTGGAAGCATAACCTACTACG |
| Internal bar code: | GGTCACCAAGAGGTTGATCGTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 920 |
| LEAP-Seq percent confirming: | 96.9449 |
| LEAP-Seq n confirming: | 1301 |
| LEAP-Seq n nonconfirming: | 41 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATGTGTGCGTGTGCAGGTAT |
| Suggested primer 2: | GGGGCTAGACTTCTGAGGCT |