| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.135508 |
| Chromosome: | chromosome 13 |
| Location: | 4499800 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g602400 | KIN8A,KIN8-1 | Kinesin motor protein; (1 of 1) K10401 - kinesin family member 18/19 (KIF18_19) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGGCCTGAGCGGCAACAGCCGCACCGCCA |
| Internal bar code: | CGCACGATGACGAGGACGACAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 699 |
| LEAP-Seq percent confirming: | 89.8734 |
| LEAP-Seq n confirming: | 213 |
| LEAP-Seq n nonconfirming: | 24 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCTGGTTAAGAACTCGTCGC |
| Suggested primer 2: | GTTGTACAGGTTGGCGTCCT |