| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.135508 |
| Chromosome: | chromosome 13 |
| Location: | 4499807 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g602400 | KIN8A,KIN8-1 | Kinesin motor protein; (1 of 1) K10401 - kinesin family member 18/19 (KIF18_19) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCAGTGGCAAGAGTGCAGGAGGAAGGAAG |
| Internal bar code: | TCGCAAATGCAACGGGCGTAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 0 |
| LEAP-Seq percent confirming: | 0.0 |
| LEAP-Seq n confirming: | 0 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 0 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTTGTACAGGTTGGCGTCCT |
| Suggested primer 2: | GCTGGTTAAGAACTCGTCGC |