| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.135620 |
| Chromosome: | chromosome 3 |
| Location: | 6722871 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g197750 | GPX3 | Glutathione peroxidase 3; (1 of 1) PTHR11592//PTHR11592:SF39 - GLUTATHIONE PEROXIDASE // SUBFAMILY NOT NAMED | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GACATCGAATACCGTAGTAATTGTTGGCTG |
| Internal bar code: | TACGTGTGTGTCGGCCGACCCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 231 |
| LEAP-Seq percent confirming: | 1.17978 |
| LEAP-Seq n confirming: | 21 |
| LEAP-Seq n nonconfirming: | 1759 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGTCACTACTGCATCGGGTT |
| Suggested primer 2: | CTCCAATCATGACGCAAATG |