Insertion junction: LMJ.RY0402.135630_1

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:+
Strain:LMJ.RY0402.135630
Chromosome:chromosome_8
Location:4144110
Confidence (%):58
Locus disrupted Locus common name Defline Orientation Feature
Cre08.g379900 antisense 3'UTR

Insertion site details

Flanking sequence (orientation from cassette outwards):AGGCCCTCCAACCGGCCTAACCACAGCCGA
Internal bar code:CCTCTCCGTAGGGCAGGTTAAC

Confirmation - LEAP-Seq

LEAP-Seq distance:616
LEAP-Seq percent confirming:99.7629
LEAP-Seq n confirming:2525
LEAP-Seq n nonconfirming:6
LEAP-Seq n unique pos:13

Suggested primers for confirmation by PCR

Suggested primer 1:ATCCTCCACGACCTATGCAC
Suggested primer 2:TCCTGCTGCGATAGTGTGAC