Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.135776 |
Chromosome: | chromosome 12 |
Location: | 1902092 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g511050 | RSP16 | Radial Spoke Protein 16; (1 of 1) K09519 - DnaJ homolog subfamily B member 13 (DNAJB13) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAGGCGCGCTTCATGTCAGGCTCTCCCCCT |
Internal bar code: | TGCGCGATCGGTGGTTAGGCAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 502 |
LEAP-Seq percent confirming: | 99.7517 |
LEAP-Seq n confirming: | 1205 |
LEAP-Seq n nonconfirming: | 3 |
LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGCTCATGCACATTCAGACT |
Suggested primer 2: | TACGAGGTCATGGGCCTTAC |