| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.135865 |
| Chromosome: | chromosome 10 |
| Location: | 6384279 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g465650 | (1 of 2) IPR001680//IPR011047//IPR017986//IPR020472//IPR027417 - WD40 repeat // Quinonprotein alcohol dehydrogenase-like superfamily // WD40-repeat-containing domain // G-protein beta WD-40 repeat // P-loop containing nucleoside triphosphate hydrolase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTTGGTCAGTGTGGAAGGGGGAGGTCGCCA |
| Internal bar code: | GCCCGGAGGACCCATTTCAACT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 270 |
| LEAP-Seq percent confirming: | 99.4904 |
| LEAP-Seq n confirming: | 66182 |
| LEAP-Seq n nonconfirming: | 339 |
| LEAP-Seq n unique pos: | 24 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCACACCCCTACCTCCTCAC |
| Suggested primer 2: | AGTAGGACACGTCGGACACC |