| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.135938 |
| Chromosome: | chromosome 5 |
| Location: | 2933456 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g238250 | BLZ2,BZIP1 | (1 of 1) K04450 - cyclic AMP-dependent transcription factor ATF-2 (ATF2, CREBP1); Basic leucine zipper1 transcription factor | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGATAGAGGGCCAGCCGACTTCAACGCAGT |
| Internal bar code: | GCGCTGTTAAGTGCAATCGGCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 686 |
| LEAP-Seq percent confirming: | 99.8917 |
| LEAP-Seq n confirming: | 922 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAGCCGTGCTCTTAGGAAAC |
| Suggested primer 2: | TGTGAAAGGAAAAGGCAACC |