| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.136025 |
| Chromosome: | chromosome 9 |
| Location: | 6993150 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g410850 | NAR3,NRT2A | High affinity nitrate/nitrite transporter; (1 of 4) K02575 - MFS transporter, NNP family, nitrate/nitrite transporter (NRT, narK, nrtP, nasA) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCTTTCTCTGCAACCTCGCGCAATGTAGG |
| Internal bar code: | GAGGGCCGCCCTCGGCTTTGGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 380 |
| LEAP-Seq percent confirming: | 99.8339 |
| LEAP-Seq n confirming: | 601 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATCTACATCCTCACCGCCAC |
| Suggested primer 2: | TCCATGCAAGAGACAAGCAC |