| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.136025 |
| Chromosome: | chromosome 14 |
| Location: | 3399292 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g630400 | L-galactose dehydrogenase; (1 of 1) 1.1.1.316 - L-galactose 1-dehydrogenase / L-galDH | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAGCTTTCTGATCTTGCTTGTGCTTCACAA |
| Internal bar code: | TAGATCCGGGGAGTCCGCGTAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 461 |
| LEAP-Seq percent confirming: | 98.7493 |
| LEAP-Seq n confirming: | 8290 |
| LEAP-Seq n nonconfirming: | 105 |
| LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGCATGCCAATGATAGAATG |
| Suggested primer 2: | CATCCCATATCCACTCACCC |