Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.136186 |
Chromosome: | chromosome 4 |
Location: | 3310937 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre04.g227000 | MLH2 | DNA mismatch repair protein; (1 of 1) K10858 - DNA mismatch repair protein PMS2 (PMS2) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AACTCACTTGCTTGGCCGCAGCTCCTGCTC |
Internal bar code: | AGGATTTGTCACGGGGCAACTC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 379 |
LEAP-Seq percent confirming: | 94.1989 |
LEAP-Seq n confirming: | 682 |
LEAP-Seq n nonconfirming: | 42 |
LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ATGGAATTGAGGCAAACAGC |
Suggested primer 2: | GAGAAGACCACCTTTGAGCG |