Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.136297 |
Chromosome: | chromosome 3 |
Location: | 4041453 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g172300 | MPC1,PHT3A,MPC5,CR057,PHT3-1,MCP1 | Mitochondrial phosphate carrier protein; (1 of 1) K15102 - solute carrier family 25 (mitochondrial phosphate transporter), member 3 (SLC25A3, PHC, PIC) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGATGGTATCGTGTCGGGCGCAAAGTTTGT |
Internal bar code: | CGACGGCACTTGTTATGCATATC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1075 |
LEAP-Seq percent confirming: | 99.095 |
LEAP-Seq n confirming: | 1533 |
LEAP-Seq n nonconfirming: | 14 |
LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GAGTGAGGCAAGGAGTGAGG |
Suggested primer 2: | TTGGATCTTTTTGGCTGGAC |