| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.136428 |
| Chromosome: | chromosome 2 |
| Location: | 3761705 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g095300 | (1 of 18) K08824 - cyclin-dependent kinase-like [EC:2.7.11.22] (CDKL) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTATCCGTGTGCGTGCGACTCCAGGGCACC |
| Internal bar code: | ACGTATTGACAGCCGGCAAATT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 357 |
| LEAP-Seq percent confirming: | 99.7225 |
| LEAP-Seq n confirming: | 2156 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGGTTGGCAAGGGTTTATTT |
| Suggested primer 2: | TGACGCTATTTTGTTGCTGC |