| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.136514 |
| Chromosome: | chromosome 7 |
| Location: | 755324 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g317864 | (1 of 15) PF13365 - Trypsin-like peptidase domain (Trypsin_2) | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGAATCTTCTGAAACTTGTGAACAAAGCTG |
| Internal bar code: | ACGCTGGGGAGGATACGCCGTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 702 |
| LEAP-Seq percent confirming: | 99.8803 |
| LEAP-Seq n confirming: | 1669 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAAGGCATTACGTCTGCTCA |
| Suggested primer 2: | ACTAGTTCGGACCCATGCAC |