Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.136561 |
Chromosome: | chromosome 13 |
Location: | 3741773 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre13.g589450 | FBB6L1 | (1 of 1) IPR002035//IPR013694 - von Willebrand factor, type A // VIT domain; FBB6 like protein 1 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAATGTGCCCCATGCCACTGGGAATGCAAG |
Internal bar code: | ACCCTGTAAATGGGGTGGGTGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 488 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 179 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GAGTGGCGCTACAGTGACAA |
Suggested primer 2: | GAAGAGGTGTTTGGCTCTGC |