Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.136563 |
Chromosome: | chromosome 7 |
Location: | 2267290 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g327650 | SMM25 | (1 of 5) PF05572 - Pregnancy-associated plasma protein-A (Peptidase_M43); S-adenosyl-L-methionine-dependent methyltransferase | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCTCATCTCTCCCTCCACGCACCTCTCTC |
Internal bar code: | CGCCTTTTCAGAATGTAAATCA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 903 |
LEAP-Seq percent confirming: | 99.7984 |
LEAP-Seq n confirming: | 5941 |
LEAP-Seq n nonconfirming: | 12 |
LEAP-Seq n unique pos: | 45 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTGATGCGTGTGTCCATCTC |
Suggested primer 2: | ATCATAGCCCTGTGTGGGTC |