| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.136575 |
| Chromosome: | chromosome 12 |
| Location: | 7903316 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g552700 | (1 of 2) IPR001190//IPR006626//IPR011050//IPR017448 - SRCR domain // Parallel beta-helix repeat // Pectin lyase fold/virulence factor // SRCR-like domain | CDS/intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGAGGCCAGTCCGCCCGGTACTGTGCATG |
| Internal bar code: | TCCGTGTCAGCCGTCTGCGATG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 962 |
| LEAP-Seq percent confirming: | 99.0329 |
| LEAP-Seq n confirming: | 1024 |
| LEAP-Seq n nonconfirming: | 10 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACACACAGCCACACACCAAT |
| Suggested primer 2: | TCCCAATAATCCCGCAAATA |