Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.136737 |
Chromosome: | chromosome 12 |
Location: | 2918132 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g501850 | FFT1 | putative fructan fructosyltransferase; (1 of 2) PTHR31953//PTHR31953:SF1 - FAMILY NOT NAMED // BETA-FRUCTOFURANOSIDASE, INSOLUBLE ISOENZYME CWINV2-RELATED | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCGTGCCTAGCCCCTCCTTTGCTACGCTC |
Internal bar code: | CGCTCTGTATCCGGCGACTTTC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 525 |
LEAP-Seq percent confirming: | 99.8069 |
LEAP-Seq n confirming: | 7753 |
LEAP-Seq n nonconfirming: | 15 |
LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TCACACGACAGGACTTCAGC |
Suggested primer 2: | CAACATCCGTGGTTGTAGCA |