| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.136830 |
| Chromosome: | chromosome 7 |
| Location: | 5954706 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g354450 | CYP743B1,CYP22,CYP743B3 | Cytochrome P450, CYP197 superfamily; (1 of 19) 1.14.14.1 - Unspecific monooxygenase / Xenobiotic monooxygenase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTAATGATAAGCGATTAAGCGCTTGACCAA |
| Internal bar code: | GTCACGGTGCGCCATAGTTCGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 635 |
| LEAP-Seq percent confirming: | 98.0531 |
| LEAP-Seq n confirming: | 6245 |
| LEAP-Seq n nonconfirming: | 124 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGATGGTGTGGCTTGTGTC |
| Suggested primer 2: | CAGGGAGCCAGCTGTAAAAG |