| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.136836 |
| Chromosome: | chromosome 11 |
| Location: | 3032143 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g478650 | (1 of 6) IPR007577//IPR029044 - Glycosyltransferase, DXD sugar-binding motif // Nucleotide-diphospho-sugar transferases | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGCAGGTATATGCTGATGCACTTCTACGG |
| Internal bar code: | ATCGGTAAAAAACAGAGAATGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 605 |
| LEAP-Seq percent confirming: | 51.3856 |
| LEAP-Seq n confirming: | 8233 |
| LEAP-Seq n nonconfirming: | 7789 |
| LEAP-Seq n unique pos: | 21 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACGCTGCTGAGTAACCGACT |
| Suggested primer 2: | GGCGCTGTATGACAGGGTAT |