| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.136839 |
| Chromosome: | chromosome 10 |
| Location: | 5012577 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g455500 | GTF4 | (1 of 2) PF17035 - Bromodomain extra-terminal - transcription regulation (BET); Global Transcription factor | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAGCATCGATGGAGATGCCTTCTTCGCGCG |
| Internal bar code: | ATAGCGCCTCCACAACGGTCAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 721 |
| LEAP-Seq percent confirming: | 99.6845 |
| LEAP-Seq n confirming: | 6004 |
| LEAP-Seq n nonconfirming: | 19 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TAGGCTGCTTGACGATGTTG |
| Suggested primer 2: | CCACCAGCAAGAATTTGGAT |