| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.136876 |
| Chromosome: | chromosome 13 |
| Location: | 95672 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g562550 | ARH1 | (1 of 1) 1.18.1.6 - Adrenodoxin-NADP(+) reductase / Nicotinamide adenine dinucleotide phosphate-adrenodoxin reductase; NADP adrenodoxin-like ferredoxin reductase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGGGGCAGGCGAGGGGAGGGGGGGAAGGA |
| Internal bar code: | CGCACGGAAGGGGTGAATCTAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 88 |
| LEAP-Seq percent confirming: | 60.3125 |
| LEAP-Seq n confirming: | 193 |
| LEAP-Seq n nonconfirming: | 127 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCAATCCTCGATGAAATGCT |
| Suggested primer 2: | CCATCATAAACCTTGGGGTG |