Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.136916 |
Chromosome: | chromosome 12 |
Location: | 4627259 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g522850 | HEL55 | (1 of 1) K12835 - ATP-dependent RNA helicase DDX42 (DDX42, SF3B125); DEAD/DEAH box helicase similar to Eukaryotic Initiation Factor 4A | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAGTCCAGCGTCGTTCGGGGGGGGGTGTAG |
Internal bar code: | CGGGCGGGATGGCCCCGGATGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 672 |
LEAP-Seq percent confirming: | 96.2366 |
LEAP-Seq n confirming: | 537 |
LEAP-Seq n nonconfirming: | 21 |
LEAP-Seq n unique pos: | 24 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCCCAAACTAAACCAGACCA |
Suggested primer 2: | ACGATGTTGAACACGCACAT |