| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.136969 |
| Chromosome: | chromosome 12 |
| Location: | 7568222 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g555450 | PMK,IPK,IMPK | (1 of 1) 2.7.1.140 - Inositol-tetrakisphosphate 5-kinase / 1D-myo-inositol-tetrakisphosphate 5-kinase; inositol-tetrakisphosphate 5-kinase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GACTGTATCACTCGAGTATGACAGTAAAGG |
| Internal bar code: | CGTCACCTAACGTCCGCAGCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 798 |
| LEAP-Seq percent confirming: | 99.7055 |
| LEAP-Seq n confirming: | 1693 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGTTCACAATCCAACGCAC |
| Suggested primer 2: | ACGTTACCATCCGCTTCATC |