Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.137036 |
Chromosome: | chromosome 2 |
Location: | 7196964 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g146250 | NFS1,NIFS1,CSD1 | (1 of 1) PTHR11601:SF34 - CYSTEINE DESULFURASE, MITOCHONDRIAL; Cysteine desulfurase | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGAGTGGTCTGATTCAGGGCGCTGACCCTG |
Internal bar code: | CTAACGGGCTCGATCGCGCTCC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1146 |
LEAP-Seq percent confirming: | 99.5 |
LEAP-Seq n confirming: | 15919 |
LEAP-Seq n nonconfirming: | 80 |
LEAP-Seq n unique pos: | 23 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGAAGGCGGAGAAGGAGAAG |
Suggested primer 2: | TGGACATCAAGAGCATCCAG |