| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.137059 |
| Chromosome: | chromosome 3 |
| Location: | 5353441 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g184250 | CAM9 | Calmodulin-like protein; (1 of 38) IPR002048//IPR011992 - EF-hand domain // EF-hand domain pair | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCCAGCACTTCACACCGCGGTACCGTATT |
| Internal bar code: | TACGATAGTGGTTGCCGCTTCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1013 |
| LEAP-Seq percent confirming: | 99.7753 |
| LEAP-Seq n confirming: | 9767 |
| LEAP-Seq n nonconfirming: | 22 |
| LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CATCACAGTTGAGGTGGGTG |
| Suggested primer 2: | GAACGCAAGTTGAAAGCACA |