Insertion junction: LMJ.RY0402.137068_1

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:-
Strain:LMJ.RY0402.137068
Chromosome:chromosome_13
Location:1616860
Confidence (%):95
Locus disrupted Locus common name Defline Orientation Feature
Cre13.g573500 FAP95 Flagellar Associated Protein antisense intron

Insertion site details

Flanking sequence (orientation from cassette outwards):AGGCACGACCGTCAGATGACTAGTAAGCTC
Internal bar code:ATTGAATTACGGCTTGCATTGT

Confirmation - LEAP-Seq

LEAP-Seq distance:875
LEAP-Seq percent confirming:99.1898
LEAP-Seq n confirming:9916
LEAP-Seq n nonconfirming:81
LEAP-Seq n unique pos:74

Suggested primers for confirmation by PCR

Suggested primer 1:CACCACTCCGACGGTAACTT
Suggested primer 2:AGACACAGAGGGAGGCTCAA