Insertion junction: LMJ.RY0402.137068_2


Insertion cassette:CIB1
Side of cassette:5'
Confidence (%):95
Locus disrupted Locus common name Defline Orientation Feature
Cre13.g573500 FAP95 Flagellar Associated Protein antisense CDS

Insertion site details

Flanking sequence (orientation from cassette outwards):ATCACAAGTGGCGAGCGCGACAGGGCGGAC

Confirmation - LEAP-Seq

LEAP-Seq distance:1265
LEAP-Seq percent confirming:99.8027
LEAP-Seq n confirming:6577
LEAP-Seq n nonconfirming:13
LEAP-Seq n unique pos:12

Suggested primers for confirmation by PCR