| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.137088 |
| Chromosome: | chromosome 16 |
| Location: | 2499567 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g660900 | KIL10 | Putative kinesin-like motor protein; (1 of 1) PTHR24115//PTHR24115:SF0 - FAMILY NOT NAMED // KINESIN-LIKE PROTEIN KLP10A | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAAGCACAGGGCCGGCAGCTCCCAGCCACG |
| Internal bar code: | AAAGGTAGTACCGGTGGCTAGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 484 |
| LEAP-Seq percent confirming: | 99.7076 |
| LEAP-Seq n confirming: | 5115 |
| LEAP-Seq n nonconfirming: | 15 |
| LEAP-Seq n unique pos: | 28 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTTTCGTGTGTCGCTCTGAA |
| Suggested primer 2: | TACCACCACCACCACTACCA |