| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.137128 |
| Chromosome: | chromosome 17 |
| Location: | 2814946 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g718950 | RCA2 | (1 of 4) IPR003959//IPR027417 - ATPase, AAA-type, core // P-loop containing nucleoside triphosphate hydrolase; RuBisCO activase-like protein | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCAGACTACCTTGTACATGTACGTGTGTGT |
| Internal bar code: | TTGGGTCTTACACGCTTAGGGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1027 |
| LEAP-Seq percent confirming: | 99.7047 |
| LEAP-Seq n confirming: | 8442 |
| LEAP-Seq n nonconfirming: | 25 |
| LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGTCCTGGTACATCTGCTCA |
| Suggested primer 2: | TCAATGAGGCTTCAATCGTG |