Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.137194 |
Chromosome: | chromosome 3 |
Location: | 3013638 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g163850 | (1 of 1) K10638 - E3 ubiquitin-protein ligase UHRF1 [EC:6.3.2.19] (UHRF1, NP95) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCTTGTGGAACACTCGGTCTGGAGGTCTG |
Internal bar code: | CTGGAGCGGGGGCAAACCATGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 957 |
LEAP-Seq percent confirming: | 99.7242 |
LEAP-Seq n confirming: | 31101 |
LEAP-Seq n nonconfirming: | 86 |
LEAP-Seq n unique pos: | 19 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGAAGCAGATGGGATCAAAA |
Suggested primer 2: | CTCCAATTCTTTCAACCCCA |