Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.137212 |
Chromosome: | chromosome 2 |
Location: | 1990314 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g088350 | SNR3 | (1 of 6) PF09335 - SNARE associated Golgi protein (SNARE_assoc); SNARE associated Golgi protein | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGGAGAGTCACCTGGGCCCACAAACTTCA |
Internal bar code: | CGACGCGTTGTGTCATTAGCTG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 974 |
LEAP-Seq percent confirming: | 99.4144 |
LEAP-Seq n confirming: | 12223 |
LEAP-Seq n nonconfirming: | 72 |
LEAP-Seq n unique pos: | 22 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTCCATCACCGTCTCTCCAT |
Suggested primer 2: | CCTTTGTCACGTGAACCCTT |